View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20159_low_26 (Length: 236)
Name: NF20159_low_26
Description: NF20159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20159_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 107 - 219
Target Start/End: Complemental strand, 8290832 - 8290720
Alignment:
| Q |
107 |
tgtgttcgtcagttcacatatttacgattttaatgactaatttgtttgttcgctcttctaaatgatgtgatatatatatgattggtcctcaacataaaac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8290832 |
tgtgttcgtcagttcacatatttacgattttaatgactaatttgtttgtttgctcttctaaatgatgtgatatatatatgattggtcctcaacataaaac |
8290733 |
T |
|
| Q |
207 |
cattgtgcattgt |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8290732 |
cattgtgcattgt |
8290720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 16 - 61
Target Start/End: Complemental strand, 8291046 - 8291001
Alignment:
| Q |
16 |
agaaggaatgtttgtgatgctcaattggaaaacattgtgcaagatt |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8291046 |
agaaggaatgtttgtgatgctcaattggaaaacattgtgcaagatt |
8291001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 87
Target Start/End: Complemental strand, 8290880 - 8290852
Alignment:
| Q |
59 |
attatcgttgaatgaaaatttctttccgt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8290880 |
attatcgttgaatgaaaatttctttccgt |
8290852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University