View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2015_high_12 (Length: 318)
Name: NF2015_high_12
Description: NF2015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2015_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 16 - 300
Target Start/End: Complemental strand, 22651371 - 22651087
Alignment:
| Q |
16 |
attggcataaataattgtagcacttctttaacctagaacgcacaaagtaataagagaattgacaggacaaattaatacagaatttgcatatagtaattca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22651371 |
attggcataaataattgtagcacttctttaacctagaacgcacaaagtaataagagaattgacaggacaaattaatacagaatttgcatatagtaattca |
22651272 |
T |
 |
| Q |
116 |
aaccaaaccgaacataaatattacaaagacaacaaagattataacagaccctacctcctccagttatgactaaataaaaacactagctaaccagaaagag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22651271 |
aaccaaaccgaacataaatattacaaagacaacaaagattataacagaccctacctcctccagttatgactaaataaaaacactagctaaccagaaagag |
22651172 |
T |
 |
| Q |
216 |
gttagggcctgaaaaatcccaacaagaccagcttaatcatagattacattcttgatcaaccaataataaaagagattggtatcac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22651171 |
gttagggcctgaaaaatcccaacaagaccagcttaatcatagattacattcttgatcaaccaataataaaagagattggtatcac |
22651087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University