View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2015_low_13 (Length: 322)
Name: NF2015_low_13
Description: NF2015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2015_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 50313991 - 50314225
Alignment:
| Q |
1 |
ttgggatgagttaggtttttatgttaaggagagtaaggcatagggtgattcatgacaagctcgctggagaagataacaaatgattattaaagcaaaggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50313991 |
ttgggatgagttaggtttttatgttaaggagagtaaggcatagggtgattcatgacaagctcgctggagaagataacaaatgattattaaagcaaaggga |
50314090 |
T |
|
| Q |
101 |
aaagaaaaagcgaggttctttggattaggagtgatgtactttggatatgtgaagtttatgatt-gtgtagtttattggtataatgttttagagctcttta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50314091 |
aaagaaaaagcgaggttctttggattaggagtgatgtactttggatatgtgaagtttatgattggtgtagtttattggcataatgttttagagctcttta |
50314190 |
T |
|
| Q |
200 |
cattgttgctttcttgggtgtcatggcctttgcat |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
50314191 |
cattgttgctttcttgggtgtcatggcctttgcat |
50314225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University