View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2015_low_14 (Length: 318)

Name: NF2015_low_14
Description: NF2015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2015_low_14
NF2015_low_14
[»] chr4 (1 HSPs)
chr4 (16-300)||(22651087-22651371)


Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 16 - 300
Target Start/End: Complemental strand, 22651371 - 22651087
Alignment:
16 attggcataaataattgtagcacttctttaacctagaacgcacaaagtaataagagaattgacaggacaaattaatacagaatttgcatatagtaattca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22651371 attggcataaataattgtagcacttctttaacctagaacgcacaaagtaataagagaattgacaggacaaattaatacagaatttgcatatagtaattca 22651272  T
116 aaccaaaccgaacataaatattacaaagacaacaaagattataacagaccctacctcctccagttatgactaaataaaaacactagctaaccagaaagag 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22651271 aaccaaaccgaacataaatattacaaagacaacaaagattataacagaccctacctcctccagttatgactaaataaaaacactagctaaccagaaagag 22651172  T
216 gttagggcctgaaaaatcccaacaagaccagcttaatcatagattacattcttgatcaaccaataataaaagagattggtatcac 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22651171 gttagggcctgaaaaatcccaacaagaccagcttaatcatagattacattcttgatcaaccaataataaaagagattggtatcac 22651087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University