View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2015_low_15 (Length: 312)
Name: NF2015_low_15
Description: NF2015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2015_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 178 - 297
Target Start/End: Original strand, 52399228 - 52399347
Alignment:
| Q |
178 |
atgtaaaaagtatatgatactatgatagttatttctaaaaagcaattgtaaagtgacaatgtgtggttttctgaaaatttctcaccgaatgaactgcaaa |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52399228 |
atgtaaaaagtatatgatactatgatagttatttctaaaaagcaattgtaaagtgacaatgtgtggttttctgaaaatttctcaccgaatgaactgcaaa |
52399327 |
T |
 |
| Q |
278 |
actaatttacatcgatagtg |
297 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52399328 |
actaatttacatcgatagtg |
52399347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 42 - 132
Target Start/End: Original strand, 52399077 - 52399167
Alignment:
| Q |
42 |
ctttctttgacttcctaagaaatannnnnnnnnnnaacctatttttactttcaattcaatgaggagatagtatgttttcaaaaatatctct |
132 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52399077 |
ctttctttgacttcctaagaaatattattttttttaacctatttttacttacaattcaatgaggagatagtatgttttaaaaaatatctct |
52399167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 50
Target Start/End: Original strand, 52398285 - 52398322
Alignment:
| Q |
13 |
aaaatataaagaaaaatgggaatacactactttctttg |
50 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52398285 |
aaaatataaagaaaaatgggtatacactactttctttg |
52398322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University