View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2015_low_18 (Length: 236)
Name: NF2015_low_18
Description: NF2015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2015_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 220
Target Start/End: Original strand, 1038712 - 1038928
Alignment:
| Q |
4 |
gatggacatcatcatagtcatatgattgcaaggtagacataatttcttatggtattgctcttgtaattgtaaactatatcaatgctataatggaacttga |
103 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1038712 |
gatgcacatcttcatagtcatatgattgcaaggtagacataatttcttatggtattgctcttgtaattgtaaactatatcaatgctataatggaacttga |
1038811 |
T |
 |
| Q |
104 |
acaaattggatttggtgattcctatatatataatgaatagtttaaaagaaattgtttgagttgagttttcttaaaaatgaaagcattcctttttggctga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1038812 |
acaaattggatttggtgattcctatatatataatgaatagtttaaaagaaattgtttgagttgagttttcttagaaatgaaagcattcctttttggctga |
1038911 |
T |
 |
| Q |
204 |
tttaacgtgatatagtt |
220 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1038912 |
tttaacgtgatatagtt |
1038928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University