View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20160_high_6 (Length: 455)
Name: NF20160_high_6
Description: NF20160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20160_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 162 - 437
Target Start/End: Complemental strand, 40439735 - 40439460
Alignment:
| Q |
162 |
cgacggccattcatggatcaccccggcggccacgctcctctttctgaacccaacactccaaccaccccaagacccaccctattcctctccacttccggca |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40439735 |
cgacggccattcatggatcaccccggcggccacgctcctctttctgaacccaacaccccaaccaccccaagacccaccctattcctctccacttcgggca |
40439636 |
T |
 |
| Q |
262 |
aagcccttcttgtctcaaactccaacaaatccctcgtcatttccaattccggcaaacgcctcgtcgagacacccagcaagaaaaaatatgttaaacaggt |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40439635 |
aagcccttcttgtctcaaactccaacaaatccctcgtcatttccaattccggcaaacgcctcgtcgagacaccctgcaagaaaaaatatgttaaacaggt |
40439536 |
T |
 |
| Q |
362 |
caccggtcgtcataatgacaccgagcttcatcttgccgcgcaacgcggtgatgctgctgctgttaggaatattctg |
437 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40439535 |
caccggtcgtcataatgacaccgagcttcatcttgccgcgcaacgcggtgatgctgctgctgttaggaatattctg |
40439460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 4 - 103
Target Start/End: Complemental strand, 40439893 - 40439794
Alignment:
| Q |
4 |
ggaggagcagagaaagcaacgatatttgtttggagtttttccgccaatggtgcagatcaacaaaaacagaggagggattgaagggttgaggaatggggca |
103 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40439893 |
ggaggaccaaagaaagcaacgatatttgtttggagttattccgccaatggtgcagatcaacaaaaacagaggagggattgaagggttgaggaatggggca |
40439794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University