View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20160_low_27 (Length: 238)
Name: NF20160_low_27
Description: NF20160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20160_low_27 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 55 - 238
Target Start/End: Complemental strand, 11351067 - 11350884
Alignment:
| Q |
55 |
aatcacgaaatcttgattctatggtaaagtaaatcctttgttttcgtggtcaaaacttcgtaacacgtaaaacattcgggtgtttaatttgtttgaacct |
154 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11351067 |
aatcacgaaatcttgattctatggtgaagtaaatcctttgtttttgtggtcaaaacttcgtaacgcgtaaaacattcgggtgtttaatttgtttgaacct |
11350968 |
T |
 |
| Q |
155 |
gcatttcaactcgctttctcaatttattagcatcgagtatttggtccttgaaggactttgctgatgaaataaaacggtctttgt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11350967 |
acatttcaactcgctttctcaatttattagcatcgagtatttggtccttgaaggactttgctgatgaaataaaacggtttttgt |
11350884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University