View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20160_low_29 (Length: 233)
Name: NF20160_low_29
Description: NF20160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20160_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 107 - 216
Target Start/End: Original strand, 33009227 - 33009336
Alignment:
| Q |
107 |
gtgtttcacaaatactttttagataacgaatttggagtaattcgttcatgtatgttagttgatagacgtagagttagatttatagtcacaacccactgtt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
33009227 |
gtgtttcacaaatactttttagataacgaatttggagtaattcgttcatgtatgttagttgatagacgtagagttagatttatagtcacaatccactctt |
33009326 |
T |
|
| Q |
207 |
ggatattaat |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
33009327 |
agatattaat |
33009336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University