View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20160_low_29 (Length: 233)

Name: NF20160_low_29
Description: NF20160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20160_low_29
NF20160_low_29
[»] chr6 (1 HSPs)
chr6 (107-216)||(33009227-33009336)


Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 107 - 216
Target Start/End: Original strand, 33009227 - 33009336
Alignment:
107 gtgtttcacaaatactttttagataacgaatttggagtaattcgttcatgtatgttagttgatagacgtagagttagatttatagtcacaacccactgtt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||    
33009227 gtgtttcacaaatactttttagataacgaatttggagtaattcgttcatgtatgttagttgatagacgtagagttagatttatagtcacaatccactctt 33009326  T
207 ggatattaat 216  Q
     |||||||||    
33009327 agatattaat 33009336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University