View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20161_high_7 (Length: 207)
Name: NF20161_high_7
Description: NF20161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20161_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 42210937 - 42211107
Alignment:
| Q |
19 |
gagactgtttgatgatagatctaaagtcacaagggatggcaaatcccctagactatttggaattgagccactaaaattgtttcttgccatcataagtgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42210937 |
gagactgtttgatgatagatctaaagtcacaagggatggcaaatcccctagactatttggaattgagccactaaaattgtttcttgccatcataagtgtt |
42211036 |
T |
 |
| Q |
119 |
ttcaatccgttaacttcgattttaggaatgttccctgacagcttgttgtccgaaacaaccatggcctctag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42211037 |
ttcaatccgttaacttcgattttaggaatgttccctgacagcttgttgtccgaaacaaccatggcctctag |
42211107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 42223153 - 42223323
Alignment:
| Q |
19 |
gagactgtttgatgatagatctaaagtcacaagggatggcaaatcccctagactatttggaattgagccactaaaattgtttcttgccatcataagtgtt |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42223153 |
gagattgtttgatgatagatctaaagtcacaagggatgctaaatcacctagactatttggaattgagccactaaaattgtttcttgccatcactagtgtt |
42223252 |
T |
 |
| Q |
119 |
ttcaatccgttaacttcgattttaggaatgttccctgacagcttgttgtccgaaacaaccatggcctctag |
189 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||| |
|
|
| T |
42223253 |
ttcaatccgtcaacttcgattttaggaatgttccctgacagcatgttgtctgaaacaaccatggccactag |
42223323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 42198361 - 42198536
Alignment:
| Q |
19 |
gagactgtttgatga-tagatctaaagtcacaagggatggcaaatcccctagactatttggaattgagccactaaaattgtttcttgccatcataagtgt |
117 |
Q |
| |
|
|||| |||||||||| |||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||| |||| | |
|
|
| T |
42198361 |
gagattgtttgatgaatagatccaaagtcacaagtgatgctaaatcccctagactatttggaattgagccactaaatttgtttctagccatcacaagtat |
42198460 |
T |
 |
| Q |
118 |
tttcaatccg-tta---acttcgattttaggaatgttccctgacagcttgttgtccgaaacaaccatggcctctag |
189 |
Q |
| |
|
|||||||||| ||| ||||| | |||||||||||||||||||| | ||||| ||||| |||||||| |||||| |
|
|
| T |
42198461 |
tttcaatccgcttaattacttctaatttaggaatgttccctgacaaccagttgttcgaaataaccatggtctctag |
42198536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University