View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20162_high_25 (Length: 236)

Name: NF20162_high_25
Description: NF20162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20162_high_25
NF20162_high_25
[»] chr4 (1 HSPs)
chr4 (68-222)||(54302079-54302233)


Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 68 - 222
Target Start/End: Original strand, 54302079 - 54302233
Alignment:
68 gttagtgtgagttcaaatctatccgtgccgttttaatagttattggtgttattcaaaaaatactaatttcatcttctnnnnnnntttagaaggnnnnnnn 167  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||       |||||||||           
54302079 gttagtgtgagttcaaatctatccgtgccgttttaacagttattggtgttattcaaaaaatactaatttcatcttctaaaaaaatttagaaggaaaaaaa 54302178  T
168 gacactaattgatctttcagagaacatgcacattctagaatacagatcttctcta 222  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
54302179 gacgctaattgatctttcagagaacatgcacattctagaatacagatcttctcta 54302233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University