View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20162_high_25 (Length: 236)
Name: NF20162_high_25
Description: NF20162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20162_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 68 - 222
Target Start/End: Original strand, 54302079 - 54302233
Alignment:
| Q |
68 |
gttagtgtgagttcaaatctatccgtgccgttttaatagttattggtgttattcaaaaaatactaatttcatcttctnnnnnnntttagaaggnnnnnnn |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54302079 |
gttagtgtgagttcaaatctatccgtgccgttttaacagttattggtgttattcaaaaaatactaatttcatcttctaaaaaaatttagaaggaaaaaaa |
54302178 |
T |
 |
| Q |
168 |
gacactaattgatctttcagagaacatgcacattctagaatacagatcttctcta |
222 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54302179 |
gacgctaattgatctttcagagaacatgcacattctagaatacagatcttctcta |
54302233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University