View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20162_low_20 (Length: 279)
Name: NF20162_low_20
Description: NF20162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20162_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 38 - 261
Target Start/End: Complemental strand, 6418242 - 6418019
Alignment:
| Q |
38 |
ttatgtttgatgtgtactactcaaattcaataaaggttgtcttgtggaaggatgctctttagtgaaagggtcgctatttcgacccactattgtgaaagga |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6418242 |
ttatgtttgatgtgtactactcaaattcaataaaggttgtcttgtggaaggatgctctttagtgaaagggtcgctatttcgacccactattgtgaaagga |
6418143 |
T |
 |
| Q |
138 |
tgctctacatacagaaaaactatctacttggaaggctaagctgatgttatcaatatgtggttgactggtgcttgtgaagtcagttcttatttcttcttaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6418142 |
tgctctacatacagaaaaactatctacttggaaggctaagctgatgttatcaatatgtggtagactggtgcttgtgaagtcagttcttatttcttcttaa |
6418043 |
T |
 |
| Q |
238 |
tagtttactctctttattctatat |
261 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6418042 |
tagtttactctctttattctatat |
6418019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University