View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20162_low_29 (Length: 208)
Name: NF20162_low_29
Description: NF20162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20162_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 70 - 190
Target Start/End: Complemental strand, 11313987 - 11313867
Alignment:
| Q |
70 |
gacaattcaattattagcattaaattggattttttatgcaaataaggataaatttttagaacactagaaattgaaacatacatattatattgactgatat |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11313987 |
gacaattcaattattagcattaaattggattttttatgcaaataaggataaatttttagaacactagaaattgaaacatacatattatattgactgatat |
11313888 |
T |
 |
| Q |
170 |
ttacataaattattctagatg |
190 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11313887 |
ttacataaattattctagatg |
11313867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 11314031 - 11313998
Alignment:
| Q |
16 |
aatatcgattttaagaattcattcaacgcctcat |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11314031 |
aatatcgattttaagaattcattcaacgcctcat |
11313998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University