View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20162_low_29 (Length: 208)

Name: NF20162_low_29
Description: NF20162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20162_low_29
NF20162_low_29
[»] chr4 (2 HSPs)
chr4 (70-190)||(11313867-11313987)
chr4 (16-49)||(11313998-11314031)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 70 - 190
Target Start/End: Complemental strand, 11313987 - 11313867
Alignment:
70 gacaattcaattattagcattaaattggattttttatgcaaataaggataaatttttagaacactagaaattgaaacatacatattatattgactgatat 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11313987 gacaattcaattattagcattaaattggattttttatgcaaataaggataaatttttagaacactagaaattgaaacatacatattatattgactgatat 11313888  T
170 ttacataaattattctagatg 190  Q
    |||||||||||||||||||||    
11313887 ttacataaattattctagatg 11313867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 11314031 - 11313998
Alignment:
16 aatatcgattttaagaattcattcaacgcctcat 49  Q
    ||||||||||||||||||||||||||||||||||    
11314031 aatatcgattttaagaattcattcaacgcctcat 11313998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University