View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20163_low_9 (Length: 268)
Name: NF20163_low_9
Description: NF20163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20163_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 35524791 - 35524559
Alignment:
| Q |
16 |
aatatgggtgaaaggtggagtatgcacatggaggagattaagttgaataaggtgtgtgtgggttggggaatggagctataatactactggtggttgcatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35524791 |
aatatgggtgaaaggtggagtatgcacatggaggagattaagttgaataaggtgtgtgtgggttggggaatggagctataatact---ggtggttgcatt |
35524695 |
T |
 |
| Q |
116 |
gtgagcatcgagtaatatggatatgtggaaggaaaatcagtcataggagggttttgtgattaggatgaagcaccaattgataccatctaaaatatttcac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35524694 |
gtgagcatcgagtaatatggatatgtggaaggaaaatcagtcataggagggttttgtgattaggatgaagcaccaattgataccatctaaaatatttcac |
35524595 |
T |
 |
| Q |
216 |
taaggaaactagggttctaagatctaaaagagaaaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35524594 |
taaggaaactagggttctaagatctaaaagagaaaa |
35524559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University