View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20164_high_9 (Length: 336)
Name: NF20164_high_9
Description: NF20164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20164_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 148 - 326
Target Start/End: Complemental strand, 24062292 - 24062113
Alignment:
| Q |
148 |
ggatcctcttttcttgatttccaaaataactggcaatgagtttctcgtcgtacctgatgttggattttgcgaggttgagaaactcgttgagggatgtggg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24062292 |
ggatcctcttttcttgatttccaaaataactggcgatgagtttctcctcgtacctgatgttggattttgcgaggttgagaaactcgttgagggatgtggg |
24062193 |
T |
|
| Q |
248 |
tcctcgatgcctgtcgccttgcggaaatcggttccttgttggagacctttttt-agtagatacatcttcaattcttcatc |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24062192 |
tcctcgatgcctgtcgccttgcggaaatcggttccttgtcggagaccttttttcagtagatacatcttcaattcttcatc |
24062113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 73
Target Start/End: Complemental strand, 24062421 - 24062367
Alignment:
| Q |
19 |
tttatcccttgagacgactagtggtgtgtgatcactaaaatgacaaccatatcct |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24062421 |
tttatcccttgagacgactagtggtgtgtgatcactaaaatgacaaccatgtcct |
24062367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 241
Target Start/End: Complemental strand, 16701919 - 16701878
Alignment:
| Q |
200 |
cctgatgttggattttgcgaggttgagaaactcgttgaggga |
241 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
16701919 |
cctgatgtaggtttttgcgaggttgagaaactcgtcgaggga |
16701878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University