View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20164_low_10 (Length: 345)
Name: NF20164_low_10
Description: NF20164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20164_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 9 - 329
Target Start/End: Original strand, 4195286 - 4195606
Alignment:
| Q |
9 |
tcttgagagtcttaatttgtttgagaataggtttaccggtgggttgccggtgagtatagctgattctccgaatctttatgagttaaaggtttttgagaat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195286 |
tcttgagagtcttaatttgtttgagaataggtttaccggtgagttgccggtgagtatagctgattctccgaatctttatgagttaaaggtttttgagaat |
4195385 |
T |
|
| Q |
109 |
ttactcaccggtgagttaccggagaagctagggaagaatggtccgttgatttattttgatgtttcgaataataagttttccggtaggattccggtgagtt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195386 |
ttactcaccggtgagttaccggagaagctagggaagaatggtccgttgatttattttgatgtttcgaataataagttttccggtaggattccggtgagtt |
4195485 |
T |
|
| Q |
209 |
tgtgtgaacgtggcgcgttggaggaacttttgatgatacataatgaattctctggcgagattcctgggagtttaggggagtgtcggacattgacgcgcgt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4195486 |
tgtgtgaacgtggcgcgttggaggaacttttgatgatacataatgaattctctggcgagattccagggagtttaggggagtgtcggacattgacgcgcgt |
4195585 |
T |
|
| Q |
309 |
taggttaggttttaataagtt |
329 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
4195586 |
taggttgggttttaataagtt |
4195606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University