View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20165_high_19 (Length: 248)
Name: NF20165_high_19
Description: NF20165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20165_high_19 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 3878957 - 3879187
Alignment:
| Q |
18 |
tgcaacttcatgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3878957 |
tgcaacttcatgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatctt |
3879056 |
T |
 |
| Q |
118 |
ggttttcttgattcatcatactgcccaagcatatctttggaggtgtgcttcaaattgtatactcgcttttttgcatatgtaagcttgtattttgaactaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3879057 |
ggttttcttgattcatcatactgcccaagcatatctttggaggtgtgcttcaaattgtatactcgcttttttgcatatgtaagcttgtattttgaactaa |
3879156 |
T |
 |
| Q |
218 |
agtatatggcttttctcttttaagtcggttc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3879157 |
agtatatggcttttctcttttaagtcggttc |
3879187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 3864958 - 3865155
Alignment:
| Q |
16 |
gctgcaacttcatgccctcaactggtgaagctggacatgcgtaactgttcttgtgtcagcgatgaaaccctgcgtgaaatagcgcagcattgtcctaatc |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
3864958 |
gctgcaacttcatgccctcaactagtgaaactggacatgcgtaattgttcttgtgtcagcgatgaaacactgcgtgaaatagcacaacattgtcctaatc |
3865057 |
T |
 |
| Q |
116 |
ttggttttcttgattcatcatactgcccaagcatatctttggaggtgtgcttcaaattgtatactcgcttttttgcatatgtaagcttgtattttgaac |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||| |||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
3865058 |
ttggttttcttgatgcatcatactgcccaaacatatctttggaggtgtgctttaaactgtatact-tattttttgcatatttaagattgtattttgaac |
3865155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University