View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20165_high_20 (Length: 248)
Name: NF20165_high_20
Description: NF20165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20165_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 21 - 203
Target Start/End: Original strand, 32726395 - 32726586
Alignment:
| Q |
21 |
actaattccttgagccggatcaatatcactcgagctaagtcacggtttttggttgaaccggttaaggcttccgcgccagccatcaataggtgcactagtt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726395 |
actaattccttgagccggatcaatatcactcgagctaagtcacggtttttggttgaaccggttaaggcttccgcgccagccatcaataggtgcactagtt |
32726494 |
T |
 |
| Q |
121 |
ttagcccttttgaatcatcaccaacttcttgcgtttttattgtcgttgtt---------gttgttgtttccatttcttcttcttcctcatcc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32726495 |
ttagcccttttgaatcatcaccaacttcatgcgtttttattgccgttgttgttgttgtggttgttgtttccatttcttcttcttcctcatcc |
32726586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University