View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20165_high_25 (Length: 230)

Name: NF20165_high_25
Description: NF20165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20165_high_25
NF20165_high_25
[»] chr1 (1 HSPs)
chr1 (24-123)||(38308420-38308519)


Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 24 - 123
Target Start/End: Original strand, 38308420 - 38308519
Alignment:
24 acatctgtcaaaagatggatttcgatagttatgaggnnnnnnncctaccagaagattggttttgatgggtgaggggggcctcgtagagccacgcccctac 123  Q
    ||||||||||||||||||||||||||||||||||||       |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
38308420 acatctgtcaaaagatggatttcgatagttatgaggaaaaaaacctaccagaagattggttctgatgggtgaggggggcctcgtagagccacgcccctac 38308519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University