View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20165_high_28 (Length: 225)
Name: NF20165_high_28
Description: NF20165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20165_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 5714950 - 5714761
Alignment:
| Q |
1 |
gtgagatttattagtaaaatgttttttgggattaacccaagcacgttgctttgataaaaatgtacaagaaaattctgtccaaaatcatgaaaaataagag |
100 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5714950 |
gtgagatttattagtaaatttttttttgggattaacccaagcacgttgctttgataaaaatgtacaagaaaattctgtccaaaatcatgaaaaataagag |
5714851 |
T |
|
| Q |
101 |
attttgttttcttctaccaaaactatgtacgcacagttccttataacccggaaagattgtaataacagctttgctggtgttcatacaaat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5714850 |
attttgttttcttctaccaaaactatgtacgcacagttccttataacccggaaagattgtaataacagctttgttggtgttcatacaaat |
5714761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University