View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20165_high_29 (Length: 222)
Name: NF20165_high_29
Description: NF20165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20165_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 46227819 - 46227657
Alignment:
| Q |
15 |
ataattctcatgcatatgagtgatgatgatgataattaatggtccccctccctcatttccagttctgtatgtcttgctataaatcaacattcaaatcatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46227819 |
ataattctcatgcatatgagtgatgatgatgataattaatggtccccctccctcatttccagttctgtatgtcttgctataaatcaacattcaaatcatc |
46227720 |
T |
 |
| Q |
115 |
aaataattatatattcttattcttataaattaatactagttttctaaccccactgcctcaaat |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46227719 |
aaataattatatattcttattcttataaattaatactagttttctaaccccactgcctcaaat |
46227657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University