View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20165_high_31 (Length: 212)
Name: NF20165_high_31
Description: NF20165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20165_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 12 - 97
Target Start/End: Complemental strand, 7235631 - 7235546
Alignment:
| Q |
12 |
gataattctgaaaccattggatcaagaagtaccatagaatcctcacttcaatacacacactatactatccctctctcatacttcac |
97 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7235631 |
gataaatctgaaaccattggatcaagaagtaccatagaatcctcacttcaatacacacactatactatccctctctcatacttcac |
7235546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 153 - 195
Target Start/End: Complemental strand, 7235490 - 7235448
Alignment:
| Q |
153 |
tgcatggatttttcttccaaatataaataaatagaatcaaaca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7235490 |
tgcatggatttttcttccaaatataaataaatagaatcaaaca |
7235448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University