View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20165_low_10 (Length: 421)
Name: NF20165_low_10
Description: NF20165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20165_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 7e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 276 - 404
Target Start/End: Complemental strand, 45895324 - 45895196
Alignment:
| Q |
276 |
tattaccatcctctccagaaacctgatcctttgaatttagtttctctgttttgaggaacattctgagagtaacccttgtgaatagtagcaggaggtggag |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45895324 |
tattaccatcctctccagaaacctgatcctttgaatttagtttctctgttttgaggaacattctgagagtaacccttgtgaacagtagcaggaggtggag |
45895225 |
T |
 |
| Q |
376 |
ctaaatatggacccgctgcagtgtctttt |
404 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
45895224 |
ctaaatatggacccactgcagtgtctttt |
45895196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 40
Target Start/End: Complemental strand, 45896157 - 45896120
Alignment:
| Q |
3 |
gtccaaacaacagtagcaacaccatccagcacaactgc |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45896157 |
gtccaaacaacagtagcaacaccatccagcacaactgc |
45896120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University