View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20165_low_24 (Length: 243)
Name: NF20165_low_24
Description: NF20165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20165_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 12 - 224
Target Start/End: Original strand, 44917702 - 44917914
Alignment:
| Q |
12 |
tgagatgaactagaacaccaaattcaagtaaaaaacattataataattaaagtctatactatagggacaatttcttagtcactatcagcatgtaccaatt |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44917702 |
tgagatgaactagaacaccaaattaaagtaaaaaacattataataattaaagtctatactatagggacaatttcttagtcactatcagcatgtaccaatt |
44917801 |
T |
 |
| Q |
112 |
attgcatgttgtaagttcatgccaaaagtactacatgaaagaaggagtaaatatcaaatccaatttgaatgcaattagtgtatatctaggaaagattccc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44917802 |
attgcatgttgtaagttcatgccaaaagtactacatgaaagaaggagtaaatatccaatccaatttgaatgcaattagtgtatatctaggaaagattccc |
44917901 |
T |
 |
| Q |
212 |
acaacaaagtaat |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44917902 |
acaacaaagtaat |
44917914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University