View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20165_low_28 (Length: 230)
Name: NF20165_low_28
Description: NF20165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20165_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 24 - 123
Target Start/End: Original strand, 38308420 - 38308519
Alignment:
| Q |
24 |
acatctgtcaaaagatggatttcgatagttatgaggnnnnnnncctaccagaagattggttttgatgggtgaggggggcctcgtagagccacgcccctac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38308420 |
acatctgtcaaaagatggatttcgatagttatgaggaaaaaaacctaccagaagattggttctgatgggtgaggggggcctcgtagagccacgcccctac |
38308519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University