View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20165_low_31 (Length: 225)

Name: NF20165_low_31
Description: NF20165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20165_low_31
NF20165_low_31
[»] chr2 (1 HSPs)
chr2 (1-190)||(5714761-5714950)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 5714950 - 5714761
Alignment:
1 gtgagatttattagtaaaatgttttttgggattaacccaagcacgttgctttgataaaaatgtacaagaaaattctgtccaaaatcatgaaaaataagag 100  Q
    |||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5714950 gtgagatttattagtaaatttttttttgggattaacccaagcacgttgctttgataaaaatgtacaagaaaattctgtccaaaatcatgaaaaataagag 5714851  T
101 attttgttttcttctaccaaaactatgtacgcacagttccttataacccggaaagattgtaataacagctttgctggtgttcatacaaat 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
5714850 attttgttttcttctaccaaaactatgtacgcacagttccttataacccggaaagattgtaataacagctttgttggtgttcatacaaat 5714761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University