View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20166_high_10 (Length: 307)
Name: NF20166_high_10
Description: NF20166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20166_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 273
Target Start/End: Original strand, 968242 - 968498
Alignment:
| Q |
17 |
acacagaggagccaatgttttaaaaaatttattaactagttttttgggttcaactcatttgaatcaactatcacataacaacaaatatagcatcatagcc |
116 |
Q |
| |
|
||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
968242 |
acacagaggagccaaggttttaaaaattctattaactagttttttgggttcaactcatttgaatcaactatctcataacaacaaatatagcatcatagcc |
968341 |
T |
 |
| Q |
117 |
aaggttttattcaagttctcttcaagttcaaaaaatatttccaagaaaaatcagagaacacaattgttcataatatccaatccaagggagatctttataa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
968342 |
aaggttttattcaagttctcttcaagttcaaaaaatatttccaagaaaaatcagagaacacaattgttcataatatctaatccaagggagatctttataa |
968441 |
T |
 |
| Q |
217 |
tagtatgtaattttcgttttcaatgagttcggtttatgccccttaggtttctgattt |
273 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
968442 |
tagtatgtaattttcattttcaatgagttcggtttatgcctcttaggtttctgattt |
968498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University