View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20166_low_13 (Length: 233)
Name: NF20166_low_13
Description: NF20166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20166_low_13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 230
Target Start/End: Complemental strand, 51178028 - 51177814
Alignment:
| Q |
15 |
agaagtacaagaaacgtgatcattcagcattgagatttgaaaaccttttatccaaaacagaagacaaaactcgttatttcttttaccatcatttggcatg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
51178028 |
agaagtacaagaaacgtgatcattcagcattgagatttgaaaaccttttatccaaaacagaagacaaaattcattatttcttt-accatcatttggcatg |
51177930 |
T |
|
| Q |
115 |
gttagaattggaatttgggtgattgagcctttacgcccctcaattcttccggcacgttcataaattgttgcaagatctgtatacatataaccaggataac |
214 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51177929 |
gttagaattggaatttgggtaattgaacctttacgcccctcaattcttccggcacgttcataaattgttgcaagatctgtatacatgtaaccaggataac |
51177830 |
T |
|
| Q |
215 |
cacgtcttcctggcac |
230 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51177829 |
cacgtcttcctggcac |
51177814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 99 - 233
Target Start/End: Original strand, 30883900 - 30884034
Alignment:
| Q |
99 |
accatcatttggcatggttagaattggaatttgggtgattgagcctttacgcccctcaattcttccggcacgttcataaattgttgcaagatctgtatac |
198 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| || || |||||||| || |||||||||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
30883900 |
accatcattgggcatggttagaattggaatttgcgtaatagagccttttcgaccctcaattcttccagcacgctcatatattgttgcaagatctgtatac |
30883999 |
T |
|
| Q |
199 |
atataaccaggataaccacgtcttcctggcacttc |
233 |
Q |
| |
|
|| ||||| |||||||||||||| || |||||||| |
|
|
| T |
30884000 |
atgtaaccgggataaccacgtctaccaggcacttc |
30884034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University