View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20166_low_9 (Length: 307)
Name: NF20166_low_9
Description: NF20166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20166_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 45 - 120
Target Start/End: Original strand, 35025987 - 35026062
Alignment:
| Q |
45 |
cacatggcatgtactcaataaatttgatttcgaggatttaaaattcactctcaagaaaattgtacatgtttgcgtc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35025987 |
cacatggcatgtactcaataaatttgatttcgaggatttaaaattcactctcaagaaaattgtacatgtttgcgtc |
35026062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 192 - 266
Target Start/End: Original strand, 35026142 - 35026212
Alignment:
| Q |
192 |
agtcggttgtaacattttgggctgtgtttgatttgatagataaatggtatatattgtacaaacaacataagacat |
266 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35026142 |
agtcggttgtaacattttgggatgtgtttgatttgata----aatggtatatattgtacaaacaacataagacat |
35026212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University