View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20168_high_10 (Length: 205)
Name: NF20168_high_10
Description: NF20168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20168_high_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 24829281 - 24829455
Alignment:
| Q |
19 |
gaaactggtaatgttgttgcagtaaagagacttggctacatgaatgacttgagcaagaaggaatttattcaacagatgcaattgctaggagagataaagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24829281 |
gaaactggtaatgttgttgcagtaaagagacttggctacatgaatgacttgagcaagaaggaatttattcaacagatgcaattgctaggagagataaagc |
24829380 |
T |
|
| Q |
119 |
atgaaaatgtagctgaaattatctccnnnnnnnattcagaagatcaaaagcttgtcatatatgaacttgtctctg |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24829381 |
atgaaaatgtagctgaaattatctccttttttcattcagaagatcaaaagcttgtcatatatgaacttgtctctg |
24829455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University