View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2016_low_6 (Length: 237)
Name: NF2016_low_6
Description: NF2016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2016_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 5 - 220
Target Start/End: Original strand, 6512472 - 6512687
Alignment:
| Q |
5 |
tttttctaaaaaagtaactaaccttaattcttcatgcaaatgattactaatgaattaggagctgccaccgccgccaaaaccaccgtcattgccatcaaca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6512472 |
tttttctaaaaaagtaactaaccttaattcttcatgcaaatgattactaatgaattaggagctgccaccgccgccaaaaccaccgtcattgccatcaaca |
6512571 |
T |
 |
| Q |
105 |
ccggtcggaatagccagtgcgcggtgaaatgggcggtggaccaccttctaaagaagaactctaattgcattctcattcatgttcgtactaaacccctcaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
6512572 |
ccggtcggaatagccagtgcgcggtgaaatgggcggtggaccaccttctaaagaagaactccaattgcattctcattcatgttcgtaccaaacctctcaa |
6512671 |
T |
 |
| Q |
205 |
ttccagtaggtattct |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6512672 |
ttccagtaggtattct |
6512687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University