View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20170_high_17 (Length: 227)
Name: NF20170_high_17
Description: NF20170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20170_high_17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 3784048 - 3783832
Alignment:
| Q |
11 |
agcaatcaagcaaggagcactatggaagtagcatagcatcagccagcataggaaagttaaagtgattttgtgaatgagtttgtcgctatgtatgtctatg |
110 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3784048 |
agcaattaagcaaggagcactaaggaagtagcatagcagcagccagcataggaaaattaaagtgattttgtgaatgagtttgtcgctatgtatgtctatg |
3783949 |
T |
 |
| Q |
111 |
ttgtgcgcattttatgtctttggtttgtcttttgttttctttaagaaggaagacaataaggagaggggatactattggaagtggagacaggtaaagaaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3783948 |
ttgtgcgcattttatgtctttggtttgtcttttgttttctttaagaaggaagacaataaggagaggggatactattggaagtggagacaggtaaagaaca |
3783849 |
T |
 |
| Q |
211 |
tagtggtcagacagctc |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3783848 |
tagtggtcagacagctc |
3783832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University