View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20170_high_8 (Length: 371)
Name: NF20170_high_8
Description: NF20170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20170_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 11 - 82
Target Start/End: Original strand, 39475082 - 39475153
Alignment:
| Q |
11 |
ggaagatcaaaaaacgaaagttgttgtggttttttgacatatcaatttacatcaaatgatagtaacctcaaa |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39475082 |
ggaagatcaaaaaacgaaagttgttgtggttttttgacatatcaatttacatcaaatgatagtaacctcaaa |
39475153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 262 - 356
Target Start/End: Original strand, 39475163 - 39475266
Alignment:
| Q |
262 |
tagtcaacgatgattgcaaagattagttaaactctaacga---------gtttataaagattgacacccctcacatttctttagttaccacttccttatg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39475163 |
tagtcaacgatgattgcaaagattagttaaactctaacaacgacacaaagtttataaagattgacacccctcacatttctttagttaccacttccttatg |
39475262 |
T |
|
| Q |
353 |
tttt |
356 |
Q |
| |
|
|||| |
|
|
| T |
39475263 |
tttt |
39475266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 329
Target Start/End: Complemental strand, 39474930 - 39474901
Alignment:
| Q |
300 |
gagtttataaagattgacacccctcacatt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39474930 |
gagtttataaagattgacacccctcacatt |
39474901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University