View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20170_low_11 (Length: 339)
Name: NF20170_low_11
Description: NF20170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20170_low_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 339
Target Start/End: Original strand, 41379296 - 41379631
Alignment:
| Q |
18 |
attataccaaagcaaaatatgtgttttggtttctctaggtatcacctaattcgttagaaactgcagtctgcagagacaaactctttcaaggatcttcagc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||| |
|
|
| T |
41379296 |
attataccaaagcaaaatatgtgttttggtttctctaggtatcacctaattcgttagaaactgtagtctgcagagaca--ctctttcgaggatcttcagc |
41379393 |
T |
 |
| Q |
118 |
gcatataacggttatgtat----------------tcttacgcataagtcaataatcgaaccccacatcatatgcttaagtaatgtgagtcacttccccc |
201 |
Q |
| |
|
|||||||||| |||||| | || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41379394 |
gcatataacgattatgtctattaaatggtgaaatttcctacgcataagtcaatagtcgaaccccacatcatatgcttaagtaatgtgagtcacttccccc |
41379493 |
T |
 |
| Q |
202 |
tcagaccacaccattttggcagtaaaatcatgtctaatgatatgccaaccattagcttagacacatcatatgcttttgttgttcaagaatccgatctcga |
301 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||| |||||||| |
|
|
| T |
41379494 |
tcagaccacatcattttggtagtaaaatcatgtctaatgatatgctaaccattagcttagacacttcatatgtttttgttgttcaagaatctgatctcga |
41379593 |
T |
 |
| Q |
302 |
acacgccaaatccaacaagattaaacagaatttcgatc |
339 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41379594 |
acacgccaaatccaacaagactaaacagaatttcgatc |
41379631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University