View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20170_low_18 (Length: 238)
Name: NF20170_low_18
Description: NF20170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20170_low_18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 4 - 238
Target Start/End: Complemental strand, 3733411 - 3733178
Alignment:
| Q |
4 |
ggagatgtgcgtgaggcgcattacaatgtgacagagagaagttttgccttgggcgcgtgagccatatggcttcagcctccggtgaggatttccggccttt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3733411 |
ggagatgtgcgtgaggcgcattacaatgtgacagagagaagttttgccttgggcgcgtgagccatatggcttcagcctccggtgaggatttccgaccttt |
3733312 |
T |
|
| Q |
104 |
ttcttcattctttcagtgttttcttcctccgacttgtttcttggggcttgggacaaaatgtccccaacttctatgtcttcaaagatttcttaaaccttga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
3733311 |
ttcttcattctttcagtgttttcttcctccgacttg-ttcttggggcttgggacataatgtccccaacttctatgtcttcaaagatttcttgaaacttga |
3733213 |
T |
|
| Q |
204 |
taactttcatttcaaagatttctctataatgaatc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3733212 |
taactttcatttcaaagatttctctataatgaatc |
3733178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University