View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20170_low_20 (Length: 229)
Name: NF20170_low_20
Description: NF20170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20170_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 115
Target Start/End: Original strand, 52180211 - 52180308
Alignment:
| Q |
18 |
aaattgtcgttttttagattatttaacaactcgattattctcataatgtcatatttatggctggagttttcacaatcgcttcaagtgttggctatatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52180211 |
aaattgtcgttttttagattatttaacaactcgattattctcataatgtcatatttatggctggagttttcacaatcgcttcaagtgttggctatatt |
52180308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University