View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20170_low_8 (Length: 371)

Name: NF20170_low_8
Description: NF20170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20170_low_8
NF20170_low_8
[»] chr1 (3 HSPs)
chr1 (11-82)||(39475082-39475153)
chr1 (262-356)||(39475163-39475266)
chr1 (300-329)||(39474901-39474930)


Alignment Details
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 11 - 82
Target Start/End: Original strand, 39475082 - 39475153
Alignment:
11 ggaagatcaaaaaacgaaagttgttgtggttttttgacatatcaatttacatcaaatgatagtaacctcaaa 82  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39475082 ggaagatcaaaaaacgaaagttgttgtggttttttgacatatcaatttacatcaaatgatagtaacctcaaa 39475153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 262 - 356
Target Start/End: Original strand, 39475163 - 39475266
Alignment:
262 tagtcaacgatgattgcaaagattagttaaactctaacga---------gtttataaagattgacacccctcacatttctttagttaccacttccttatg 352  Q
    |||||||||||||||||||||||||||||||||||||| |         |||||||||||||||||||||||||||||||||||||||||||||||||||    
39475163 tagtcaacgatgattgcaaagattagttaaactctaacaacgacacaaagtttataaagattgacacccctcacatttctttagttaccacttccttatg 39475262  T
353 tttt 356  Q
    ||||    
39475263 tttt 39475266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 329
Target Start/End: Complemental strand, 39474930 - 39474901
Alignment:
300 gagtttataaagattgacacccctcacatt 329  Q
    ||||||||||||||||||||||||||||||    
39474930 gagtttataaagattgacacccctcacatt 39474901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University