View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20171_high_10 (Length: 317)
Name: NF20171_high_10
Description: NF20171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20171_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 43380963 - 43380764
Alignment:
| Q |
18 |
agtgggttccttatgtttcttagctgcatgcagaattgtttgcaagatctgcaggggatccccatggctgacaaccaaaatcgcacatctgcatgatgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43380963 |
agtgggttccttatgtttcttagctgcatgaagaattgtttgcaagatctgcaggggatccccatggctgacaaccaaaatcgcacatctgaatgatgtg |
43380864 |
T |
 |
| Q |
118 |
gaatggaatgagattgattgatactagatcacaagccaaaataaaatattcaccaactgaaattttgaaaagtatttgcatgttacggtgaatcttttgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43380863 |
gaatggaatgagattgattgatactagatcacaagacaaaataaaatattgactaactgaaattttgaaaagtatttgcatgttacagtgaatcttttgt |
43380764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 214 - 303
Target Start/End: Complemental strand, 43380718 - 43380629
Alignment:
| Q |
214 |
ttgtgataaaaaagacacatactagaagaatttcaaatgatatttaaaggcagaaatgggtacccttcaaattcttgttcgaaaatggcc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43380718 |
ttgtgataaaaaagacacatactagaagaatttcaaatgatatttaaaggcagaaatgggtacccttcaaattcttgttcgataatggcc |
43380629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University