View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20171_high_18 (Length: 222)
Name: NF20171_high_18
Description: NF20171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20171_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 8 - 207
Target Start/End: Original strand, 38964936 - 38965135
Alignment:
| Q |
8 |
ggtagataatactttaagatttgtatattctgatgaacttcattttaaactttatattcataaaaataaggacataaatttatctaatcaatgacggttg |
107 |
Q |
| |
|
|||| |||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
38964936 |
ggtaaataatattttaaaatttgtatattccgatgaacttcattttaaactttatattcataaaaataaggacataaatttatctaaccaatgaaggttg |
38965035 |
T |
 |
| Q |
108 |
ccacatatctttcactcatataagtgctcacttgaaaggttataagtaaacttcatcgatgattctttataacattttataaaaaattaatgatattatt |
207 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| ||| |||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
38965036 |
ccacatatcttccactcatataagtgttcacttaaaaagttataagcaaacttcatcgatgattcttcgtatcattttataaaaaattaatgatattatt |
38965135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University