View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20171_high_19 (Length: 213)
Name: NF20171_high_19
Description: NF20171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20171_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 198
Target Start/End: Original strand, 2327629 - 2327815
Alignment:
| Q |
15 |
agatttgtcacattggtaagattttgcttcatacaatgatccattgtgcatacatatgcttttactatcatagttgttcatttttatatatcttgtttat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2327629 |
agatttgtcacattggtaagattttgcttcatacaacgatccattatgcatacatatgcttttactatcatagttgttcatttttatatatcttgtttct |
2327728 |
T |
 |
| Q |
115 |
ggtatagaataaaacgtgctagcataacataagttaatgta---gttataatattaaaacttgctttattttggtagactgacacag |
198 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2327729 |
ggtatagaataaaacgtgctcgcataacataagttaatgtagttgttataatattaaaacttgctttattttggtagactgatacag |
2327815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 34 - 129
Target Start/End: Original strand, 2331351 - 2331446
Alignment:
| Q |
34 |
gattttgcttcatacaatgatccattgtgcatacatatgcttttactatcatagttgttcatttttatatatcttgtttatggtatagaataaaac |
129 |
Q |
| |
|
||||||| ||||| ||||||| || ||||||||||| | |||||||||||||||||||||| ||| ||||||||||| | |||| |||||||| |
|
|
| T |
2331351 |
gattttgtttcatcaaatgatcacttatgcatacatattcctttactatcatagttgttcattcttacatatcttgtttcttatataaaataaaac |
2331446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 129
Target Start/End: Original strand, 2304214 - 2304275
Alignment:
| Q |
68 |
atatgcttttactatcatagttgttcatttttatatatcttgtttatggtatagaataaaac |
129 |
Q |
| |
|
|||||| |||| ||||||| ||||||||| ||||||||||||||| | ||||| |||||||| |
|
|
| T |
2304214 |
atatgcctttaatatcataattgttcattcttatatatcttgtttcttgtataaaataaaac |
2304275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University