View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20171_low_10 (Length: 317)

Name: NF20171_low_10
Description: NF20171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20171_low_10
NF20171_low_10
[»] chr5 (2 HSPs)
chr5 (18-217)||(43380764-43380963)
chr5 (214-303)||(43380629-43380718)


Alignment Details
Target: chr5 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 43380963 - 43380764
Alignment:
18 agtgggttccttatgtttcttagctgcatgcagaattgtttgcaagatctgcaggggatccccatggctgacaaccaaaatcgcacatctgcatgatgtg 117  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
43380963 agtgggttccttatgtttcttagctgcatgaagaattgtttgcaagatctgcaggggatccccatggctgacaaccaaaatcgcacatctgaatgatgtg 43380864  T
118 gaatggaatgagattgattgatactagatcacaagccaaaataaaatattcaccaactgaaattttgaaaagtatttgcatgttacggtgaatcttttgt 217  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||||    
43380863 gaatggaatgagattgattgatactagatcacaagacaaaataaaatattgactaactgaaattttgaaaagtatttgcatgttacagtgaatcttttgt 43380764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 214 - 303
Target Start/End: Complemental strand, 43380718 - 43380629
Alignment:
214 ttgtgataaaaaagacacatactagaagaatttcaaatgatatttaaaggcagaaatgggtacccttcaaattcttgttcgaaaatggcc 303  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
43380718 ttgtgataaaaaagacacatactagaagaatttcaaatgatatttaaaggcagaaatgggtacccttcaaattcttgttcgataatggcc 43380629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University