View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20173_high_2 (Length: 341)
Name: NF20173_high_2
Description: NF20173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20173_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 133 - 323
Target Start/End: Original strand, 6305758 - 6305957
Alignment:
| Q |
133 |
taaaaagataaggaatgcctggaagtgttactatttacgcttacaatggaacttaattatatagtccaaggcatgtgaatacatgaagtattggattaat |
232 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6305758 |
taaaaagataaggaatgcctggacgtgttactatttacgcttacaatggaacttaattata--gtccaaggcatgtgaatacatgaagtattggattaat |
6305855 |
T |
|
| Q |
233 |
gatg---cctttta----gattcgaaagcttatattgacatgtgaatacatga----agctgtccgtgatcatccatacatttgattttcagagtctctt |
321 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6305856 |
gatgatgccttttatttagattcgaaagcttatattgacatgtgaatacatgaatgaagctgtccgtgatcatccatacatttgattttcagagtctctt |
6305955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 6305686 - 6305730
Alignment:
| Q |
1 |
caaattggcagcatcttatgcagcatacgtaccttcatacacagt |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6305686 |
caaattggcagcatcttatgcagcatacgtaccttcataaacagt |
6305730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University