View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20173_high_6 (Length: 251)
Name: NF20173_high_6
Description: NF20173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20173_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 51 - 237
Target Start/End: Complemental strand, 7108439 - 7108253
Alignment:
| Q |
51 |
agggttaggtattagatatctaatccatcttaatgaagcttataatcttaagctttgttgagagaatggcgtcttctgatacggatcgggcaaagatgtt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7108439 |
agggttaggtattagatatctaatccatcttaatgaagcttataatcttaagctttgttgggagaatggcgtcttctgatacggattgggcaaagatgtt |
7108340 |
T |
 |
| Q |
151 |
aaggtctagagttttaaaaaacgatagatgtatttcttatcatattttctcctctttatcgagtagttttaaaagtgagtataatct |
237 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108339 |
aaggtctagagttttaaaaaatgatagatgtatttcttatcatattttctcctctttatcgagtagttttaaaagtgagtataatct |
7108253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University