View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20173_low_15 (Length: 236)
Name: NF20173_low_15
Description: NF20173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20173_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 35925749 - 35925528
Alignment:
| Q |
1 |
aaagaaaacaatcatgtcttttaaaatatcatttcccgaacctaaaccgaaaaaatatcaacaacttttcggttttactgaatattagatggagacttca |
100 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35925749 |
aaagcaaacaatcatgtcttttggaatatcatttcccgaacctaaaccgaaaaaatatcaagaacttttcggttttactgaaaattagatggagacttca |
35925650 |
T |
 |
| Q |
101 |
tgtcctgatcatttgcagtactagttgttgttgtgggatttatgtttccatctgcagctggtgaaaggtgactcgactgtcctacttctttgacaatctc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
35925649 |
tgtcctgatcatttaatgtactagttgttgttgtgggatttatgtttccatctgcagccggtaaaaggtgactcgattgtcttacttctttgacaatctc |
35925550 |
T |
 |
| Q |
201 |
tttggaatctgaattactattt |
222 |
Q |
| |
|
|| |||||||||||||| |||| |
|
|
| T |
35925549 |
ttcggaatctgaattaccattt |
35925528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 91 - 163
Target Start/End: Original strand, 35556048 - 35556123
Alignment:
| Q |
91 |
ggagacttcatgtcctgatcatttgcagtacta---gttgttgttgtgggatttatgtttccatctgcagctggtg |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||| ||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
35556048 |
ggagacttcatgtcctgatcattcgcagtactagtggttgtcgttttgggatttatgtttccacctgcagccggtg |
35556123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 91 - 158
Target Start/End: Original strand, 35544816 - 35544886
Alignment:
| Q |
91 |
ggagacttcatgtcctgatcatttgcagtactagttg---ttgttgtgggatttatgtttccatctgcagc |
158 |
Q |
| |
|
|||||||| |||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35544816 |
ggagactttttgtcctgatcatttgcagcacgagttgttgttgttgtgggatttatgtttccatctgcagc |
35544886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 156
Target Start/End: Complemental strand, 34990694 - 34990641
Alignment:
| Q |
103 |
tcctgatcatttgcagtactagttgttgttgtgggatttatgtttccatctgca |
156 |
Q |
| |
|
|||||||||||||| | || |||||||| ||||||||||||||||||||||||| |
|
|
| T |
34990694 |
tcctgatcatttgctgcaccagttgttgatgtgggatttatgtttccatctgca |
34990641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 91 - 130
Target Start/End: Complemental strand, 35919930 - 35919891
Alignment:
| Q |
91 |
ggagacttcatgtcctgatcatttgcagtactagttgttg |
130 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
35919930 |
ggagacttcatgtcctgattatttgccgtactagttgttg |
35919891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 152
Target Start/End: Original strand, 35527669 - 35527723
Alignment:
| Q |
101 |
tgtcctgatcatttgcagtac---tagttgttgttgtgggatttatgtttccatc |
152 |
Q |
| |
|
|||||||||||||||||| || | ||||||||||||||||||| ||||||||| |
|
|
| T |
35527669 |
tgtcctgatcatttgcagcaccagttgttgttgttgtgggatttaagtttccatc |
35527723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 131
Target Start/End: Complemental strand, 35891482 - 35891442
Alignment:
| Q |
91 |
ggagacttcatgtcctgatcatttgcagtactagttgttgt |
131 |
Q |
| |
|
|||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
35891482 |
ggagacttcaagtcctcatgatttgcagtactagttgttgt |
35891442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University