View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20173_low_16 (Length: 235)
Name: NF20173_low_16
Description: NF20173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20173_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 36064545 - 36064753
Alignment:
| Q |
13 |
gaagcaaaggttgagtgctaacaaacttgctggtatttctgtttcattgtttgcttaatttgagcaaaaaatcaaggaggaatagttggtgttgtttctc |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064545 |
gaagccaaggttgagtgctaacaaacttgctggtatttctgtttcattgtttgcttaatttgagcaaaaaatcaaggaggaatagttggtgttgtttctc |
36064644 |
T |
|
| Q |
113 |
ttgttgagtaaatagattgctcctgttgttcttgtatattgaactatacattagaagggctttttagagggatcaagatcttcaaatcattcattgaaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36064645 |
ttgttgagtaaatagattgctcctgttgttcttgtatattgaactatacattagaagggctttttagagggatcaagatcttcaaatcattcattgaaga |
36064744 |
T |
|
| Q |
213 |
ttgattttg |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
36064745 |
ttgattttg |
36064753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University