View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20173_low_8 (Length: 269)
Name: NF20173_low_8
Description: NF20173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20173_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 17 - 252
Target Start/End: Original strand, 34830241 - 34830476
Alignment:
| Q |
17 |
taggttcagagaagtatagcttttagtttacattgtttgagtgattttgaacaatgaaccagaaaagcaaactagctattaacactgaaaatggaagaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34830241 |
taggttcagagaagtatagcttttagtttacattgtttgagtgattttgaacaatgaaccagaaaagcaaactagctattaacactgaaaatggaagaaa |
34830340 |
T |
 |
| Q |
117 |
aaattgattatacacttaatttacactgaaaagagacctgactatagacacaaaaattgcttttggaaaaggcttttgaaccagatctgtttcaaacact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34830341 |
aaattgattatacacttaatttacactgaaaagagacctgactatagacacaaaaattgcttttggaaaaggcttttgaaccagatctgtttcaaacact |
34830440 |
T |
 |
| Q |
217 |
ggcgaagcgaaaatatggtaatttcagaggctgagt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34830441 |
ggcgaagcgaaaatatggtaatttcagaggctgagt |
34830476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University