View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20174_high_26 (Length: 296)
Name: NF20174_high_26
Description: NF20174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20174_high_26 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 61 - 296
Target Start/End: Original strand, 46902398 - 46902637
Alignment:
| Q |
61 |
aactagttgatcttagagactatgcgcgctattttttcgtgtcaaccatccgatttttggagaaatgatctatgataattcagagttcgaccttgaggta |
160 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46902398 |
aactagttgatcttagagactatgcacgctattttttcgtgtcaaccatccgatttttggagaaaggatctatgataattcagagttcgaccttgaggta |
46902497 |
T |
|
| Q |
161 |
gactacacataaaatatttctctagtttatgaagagtgtacatataatatttctctagtttatgaactaatttgat----gagagagagatgaaattgat |
256 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
46902498 |
gactacacataaaatatttctcttgtttatgcagagtgtacacataatatttctctagtttatgaactaatttgatgagagagagagagatgaaatagat |
46902597 |
T |
|
| Q |
257 |
gatctcttttagttaaagaaatgatatttgtacaactatt |
296 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||| ||||||| |
|
|
| T |
46902598 |
gatctcttttacttagagaaatgatacttgtataactatt |
46902637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 23 - 62
Target Start/End: Original strand, 46902331 - 46902370
Alignment:
| Q |
23 |
tagcagggacttttattagtcccttatttccttttaaaaa |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46902331 |
tagcagggacttttattagtcccttatttccttttaaaaa |
46902370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University