View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20174_high_45 (Length: 223)
Name: NF20174_high_45
Description: NF20174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20174_high_45 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 90 - 205
Target Start/End: Complemental strand, 4591379 - 4591262
Alignment:
| Q |
90 |
gaaagattaacatagttataagttaattatgattagttgtcggttgctaatattagtgacac--nnnnnnngttgttgaggaaattagcgaccttgatca |
187 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
4591379 |
gaaagattaagatagctataagttagttatgattagttgtcggttgctaatattagtgaccctttattttttttgttgaggaaattagcaaccttgatca |
4591280 |
T |
|
| Q |
188 |
ctatataaagtgtattat |
205 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4591279 |
ctatataaagtgtattat |
4591262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University