View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20174_low_30 (Length: 292)
Name: NF20174_low_30
Description: NF20174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20174_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 12268867 - 12269132
Alignment:
| Q |
1 |
aaaacaatgcgttgtgatgatgttaaagattatgctagtcgtaactcatgctcgtgatttacttcaatcacaagtaattgagccaaatggnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12268867 |
aaaacaatgcgttgtgatgatgttaatgattatgctagtcgtaactcatgctcgtgatttacttcaatcacaagtaattgagccaaatggtttttttttt |
12268966 |
T |
 |
| Q |
101 |
ccgcatattacgtgtcgtgctaggtgtttgaatccattgaaatatcacaaatatataccatcatgttttaagtcactagaatcagtcacaaacctcgtga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12268967 |
ccgcatattacgtgtcgtgctaggtgtttgaatccattgaaatatcacaaatatataccatcatgttttaagtcactagaatcagtcacaaacctcgaga |
12269066 |
T |
 |
| Q |
201 |
attattatttttgctacgaaaaatgttatgaggaatgtattaattgaataatggtattcatacttt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12269067 |
attattatttttgctacgaaaaatgttatgaggattgtattaattgaataatggtattcatacttt |
12269132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University