View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20174_low_33 (Length: 274)
Name: NF20174_low_33
Description: NF20174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20174_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 18 - 133
Target Start/End: Complemental strand, 15263217 - 15263102
Alignment:
| Q |
18 |
gcagcactatgatgttgaagttgattgatctgtcctaagctagcagatatattcatagccaagagactagcatcgtagttgctcccaattccaccatcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15263217 |
gcagcactatgatgttgaagttgattgatctgtcctaagctagcagatatattcatagccaagagactagcatcatagttgctcccaattccaccatcaa |
15263118 |
T |
 |
| Q |
118 |
aatttcttaccaaatt |
133 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
15263117 |
aatttctaaccaaatt |
15263102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 197 - 258
Target Start/End: Complemental strand, 15263047 - 15262986
Alignment:
| Q |
197 |
gtcacggccgttactgttattaccaccaccagcagtattctgcgtgtggttgtaattacctg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
15263047 |
gtcacggccgttactgttattaccaccaccagcagtattttgcgtgtggtggtaattacctg |
15262986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University